Name: CB-5775-3		AC: AJ545696
Element	Chromosome	Map Location	End
RS	2L	21B2	5
Scaffold Location	Blast Strand Match	Element Orientation
161120	Minus	forward

---

---

Sequence

CCACACACCAACAGCATTTACCAGAAAGAGAGCGC

Blastn

" Score = 69.9 bits (35), Expect = 2e-12Identities = 35/35 (100%)Strand = Plus / Minus"

Genes near CB-5775-3:

Gene name	Distance from element (bp)	Relative location
CG3436	4495	proximal
CG18497	0	in_gene

Gene Details:

Gene	Location	Details	Strand	Start	Stop
CG18497	intron	CG18497:1_CG18497:2	plus	159820	162591
CG18497	intron	CG18497:12_CG18497:2	plus	159824	162591

P elements in range of CB-5775-3:

Element accession number	Search range of element (bp)
G00736	1000
AQ074061	1000
AQ025806	1000
AQ073627	1000
AQ025855	1000
AQ254876	1000