Name: CB-5496-3		AC: AJ547546
Element	Chromosome	Map Location	End
RS	2L	23A3	3
Scaffold Location	Blast Strand Match	Element Orientation
2743544	Minus	backward

---

---

Sequence

GGACAACCTGTGCCAATTTCTCGAGTTATCGGCTTGGTTGGTACGACCGTAGTTACTTCAAGGTTAGACAACGGTTTCAAATGCAGGCAACCACCGG

Blastn

" Score = 192 bits (97), Expect = 1e-48Identities = 97/97 (100%)Strand = Plus / Minus"

Genes near CB-5496-3:

Gene name	Distance from element (bp)	Relative location
CG2843	4031	proximal
CG3127	2453	proximal
CG9894	1824	distal

Gene Details:

Gene	Location	Details	Strand	Start	Stop

P elements in range of CB-5496-3:

Element accession number	Search range of element (bp)