Name: CB-0243-3		AC: AJ545502
Element	Chromosome	Map Location	End
RS	2L	22D4	5
Scaffold Location	Blast Strand Match	Element Orientation
2214632	Minus	forward

---

---

Sequence

GCCAGCGAATGCGAGAGAGCATCGTCAGCTGTTTTGCGATTGCAATCAATTCTCTCCGTCTCTCTCTCTGTTGTTTACTTTGCCGG

Blastn

" Score = 99.6 bits (50), Expect = 1e-20Identities = 50/50 (100%)Strand = Plus / Minus"

Genes near CB-0243-3:

Gene name	Distance from element (bp)	Relative location
CG15386	4897	proximal
CG7074	1440	proximal
CG7082	0	in_gene
CG7085	4472	distal
CG15387	3733	distal

Gene Details:

Gene	Location	Details	Strand	Start	Stop
CG7082	intron	CG7082:1_CG7082:2	plus	2213519	2215809

P elements in range of CB-0243-3:

Element accession number	Search range of element (bp)