Name: 5-SZ-3989		AC: AJ546753
Element	Chromosome	Map Location	End
RS	2L	22B2	5
Scaffold Location	Blast Strand Match	Element Orientation
1739130	Plus	backward

---

---

Sequence

GTTTAGTTGATCGGCAGCGAGCGTGGCGAGCGC

Blastn

" Score = 65.9 bits (33), Expect = 3e-11Identities = 33/33 (100%)Strand = Plus / Plus"

Genes near 5-SZ-3989:

Gene name	Distance from element (bp)	Relative location
CG17646	0	in_gene

Gene Details:

Gene	Location	Details	Strand	Start	Stop
CG17646	intron	CG17646:1_CG17646:2	plus	1734320	1743324

P elements in range of 5-SZ-3989:

Element accession number	Search range of element (bp)
AQ025947	100
AQ073644	100
AQ254866	100
AQ026001	100
AQ025901	100
AQ073605	100
AQ025947	1000
AQ073644	1000
AQ254866	1000
AQ026001	1000
AQ025901	1000
AQ073605	1000