Name: 5-HA-2872		AC: AJ622557
Element	Chromosome	Map Location	End
RS	2L	22A6	5
Scaffold Location	Blast Strand Match	Element Orientation
1659074	Plus	backward

---

---

Sequence

CCCCACGCACTCTGTGAGCTTTTGTAGGCGC

Blastn

" Score = 61.9 bits (31), Expect = 5e-10Identities = 31/31 (100%)Strand = Plus / Plus"

Genes near 5-HA-2872:

Gene name	Distance from element (bp)	Relative location
CG31666	0	in_gene

Gene Details:

Gene	Location	Details	Strand	Start	Stop
CG31666	intron	CG31666:12_CG31666:4	plus	1655502	1691781

P elements in range of 5-HA-2872:

Element accession number	Search range of element (bp)