Name: 5-HA-1779		AC: AJ545193
Element	Chromosome	Map Location	End
RS	2L	24A2	5
Scaffold Location	Blast Strand Match	Element Orientation
3624759	Minus	forward

---

---

Sequence

CTCCAGTGTTTCGAATCCCGATCTTCGGGCAATTCGTCATTCGTCCGGCAGGCGGCGTAGCGAGAAAACGTGTGTGGCGC

Blastn

" Score = 159 bits (80), Expect = 1e-38Identities = 80/80 (100%)Strand = Plus / Minus"

Genes near 5-HA-1779:

Gene name	Distance from element (bp)	Relative location
CG10033	0	in_gene

Gene Details:

Gene	Location	Details	Strand	Start	Stop
CG10033	intron	CG10033:11_CG10033:12	minus	3618786	3626807

P elements in range of 5-HA-1779:

Element accession number	Search range of element (bp)
AQ073461	100
AQ073599	100
AQ073439	100
AQ073291	100
AQ073461	1000
AQ073599	1000
AQ073439	1000
AQ073291	1000
AQ034143	1000