Name: 5-HA-1143		AC: AJ545062
Element	Chromosome	Map Location	End
RS	2L	23F6	5
Scaffold Location	Blast Strand Match	Element Orientation
3470876	Minus	forward

---

---

Sequence

GGTCGGCTGATGTTTTTTGTTTTTATCTGGTGTATTTTCTGCGTAGTTTATGACAAAC

Blastn

" Score = 67.9 bits (34), Expect = 2e-11Identities = 34/34 (100%)Strand = Plus / Minus"

Genes near 5-HA-1143:

Gene name	Distance from element (bp)	Relative location
CG31956	2969	proximal
CG8846	127	distal
CG15414	2647	distal

Gene Details:

Gene	Location	Details	Strand	Start	Stop

P elements in range of 5-HA-1143:

Element accession number	Search range of element (bp)
AQ073515	100
AQ073435	100
AQ073426	100
AQ074090	100
AQ025011	100
AQ024963	100
AQ073443	100
AQ025649	100
AQ025689	100
AQ074090	1000
AQ073426	1000
AQ024963	1000
AQ073435	1000
AQ025011	1000
AQ073681	1000
AQ073515	1000
AQ025845	1000
AQ026059	1000
AQ074032	1000
AQ073443	1000
AQ025649	1000
AQ025689	1000