Methods


DrosDel

Information
RS Elements
Deletion Crosses
Informatics
Confirming Df's
Publications

Drosophila sequencing method for 96-well plates


Fly Collection
DNA Preparation
Restriction
Ligation
PCR
PCR Purification
Sequencing
Buffers
Primers

1. Collect ~15 flies into each well of a 1.2ml mircotitre plate (ABgene). Keep the plate on ice while transferring the flies to keep them asleep / lethargic.
2. Freeze plate at -80°C until needed.

DNA preparation

1. Switch on 65°C water bath.
2. Place one grinding ball in each well and add 150ul of Buffer A. Seal the plate with PCR Sealing Film (ABgene).
3. Put plate in adapters and attach to the grinder.
4. Grind for 1min at 20/s.
5. Pulse plate to 4000rpm in a centrifuge.
6. Add an additional 150ul Buffer A. Replace plate in the grinder in the opposite orientation.
7. Grind for 1min at 20/s.
8. Grind for 1min at 20/s.
9. Pulse plate to 4000rpm.
10. Incubate plate in a 65°C water bath for 30mins. Place a weight on top of the plate to stop the lid coming off, and check every 10mins that i t hasn't.
11. Pulse plate to 4000rpm.
12. Add 600ul 6M LiCl / 5MKAc (ratio 2.5:1), invert plate ~3 times and incubate on ice for 20min.
13. Spin plate 4000rpm 15min.
14. Transfer 600ul of supernatant to a new 1.2ml plate. Try to avoid carrying over any gunk.
15. Add 450ul ice-cold isopropanol (propan-2-ol) and mix.
16. Spin 4000rpm 30 min.
17. Aspirate supernatant and wash in 500ul 70% EtOH.
18. Spin 4000rpm 15min.
19. Aspirate supernatant and dry pellet at 37°C.
20. Resuspend pellet in 50ul Sigma water.
21. Transfer samples to a 0.2ml ABgene plate and seal with adhesive film (ABgene).
22. Add 1ul 10mg/ml RNase and incubate at 55°C for 20min.
23. Run a 1% agarose gel to check samples.

Restriction of genomic DNA

1. Set up the following reaction in a 0.2ml PCR plate (ABgene). Use Roche Msp1.

x1x100
Genomic DNA 5ul -
10x Reaction Buffer 2.5ul 250ul
Msp1 10U/ul 1ul 100ul
MQ 16.5ul 1650ul

2. Seal plate with transparent adhesive seal.
3. Incubate 3hr at 37°C, and then 40min at 65°C in the PCR machine.
4. Run 5ul of reaction on a 1% agarose gel to check that the reaction has worked.

Ligation of restricted DNA

1. Set up the following reaction in a 1.2ml microtitre plate:

x1x100
Digested genomic DNA5ul-
5x Ligation buffer (ABgene)40ul4000ul (4ml)
MQ (Sigma)154.9ul15,490ul (15.49ml)
T4 Ligase 10U/ul (ABgene)0.1ul 10ul

2. Incubate plate at RT for 2hr.
3. Add 20ul 3M NaAc and 500ul 96% EtOH to each well and mix.
4. Incubate -20°C for 20min.
5. Spin plate 4000rpm 30min.
6. Decant supernatant and wash pellet in 500ul 70% EtOH.
7. Spin plate 4000rpm 15min.
8. Decant supernatant and dry pellet.
9. Re-suspend pellet in 50ul MQ (Sigma).

PCR

1. Set up the following reaction in a 0.2ml PCR plate (ABgene):

x1 x100 x50
10x Buffer (ABgene) 2.5ul 250ul 125ul
2mM dNTPs (Sigma) 1.5ul 150ul 75ul
25mM MgCl2 (ABgene) 1.5ul 150ul 75ul
Primer 1 10uM (Sigma) 1ul 100ul 50ul
Primer 2 10uM (Sigma) 1ul 100ul 50ul
Thermostart Taq (ABgene)0.1ul 10ul 5ul
MQ (Sigma) 12.4ul 1240ul 620ul
DNA 5ul - -

2. Run PCR program BDGP-P (PRY, RS3 55°C anneal ) or BDGP_2 (PLAC 60°C anneal):

95°C 15min
95°C 30sec              }
Anneal °C 1min          }   x35 cycles
72°C 2min               }
72°C 10min
3. Run 5ul of product on a 2% agarose gel to check reaction has worked.

Purification of PCR products

1. Purify products using a Millipore Multiscreen PCR Purification plate.
2. Add the remaining 20ul PCR product (left after running the agarose gel) to a purification plate on a vacuum manifold.
3. Switch on vacuum for 10min at ~12-15Hg.
4. Add 20ul MQ (Sigma) to each well.
5. Mix by pipetting and transfer well contents to a 0.2ml microtitre plate.

Sequencing of purified PCR products

1. Set up the following reaction in a non-skirted 0.2ml PCR plate:

x1 x100
BigDye Terminator mix 4ul 400ul
1.6pmol/ul Primer 1ul 100ul
PCR Product 5ul -

2. Perform sequencing reaction in PCR machine using program SEQ.CYC (standard cycling method from protocol).
3. Add 25ul ice cold 96% EtOH and 1ul NaAc (Applied Biosystems) to each sample and mix.
4. Precipitate at room temperature for 15min exactly.
5. Spin plates at 4000rpm 30min.
6. Decant supernatant and wash pellets in 125ul 70% EtOH.
7. Spin plates 4000rpm for 15min.
8. Decant supernatant and spin plates upside-down on a tissue at 250rpm for 1min.
9. Make sure that no liquid remains in the tubes, or unincorporated terminators will be carried over.
10. Dry pellets, cover plate and store at -20°C until needed, or add 10ul HiDi formamide loading buffer and run on the ABI3100 sequencer immedia tely.

Buffers

Buffer A

100mM Tris-HCl (pH 7.7)
100mM EDTA
100mM NaCl
0.5% SDS
Store at room temperature

5x Ligation Buffer

330mM Tris-HCl (pH 7.6)
33mM MgCl2
5mM DTT
300uM ATP

Primers for amplifying up the 3' end of RS elements:
RS3-1A  TTATGAGTTAATTCAAACCCCAC
RS3-2   TACGTACTCGCGATGAGCAC
PRY1	CCTTAGCATGTCCGTGGGGTTTGAAT
PRY4	CAATCATATCGCTGTCTCACTCA

Primers for amplifying up the 5' end of the RS elements:
RS5F    CGTACTTTGGAGTACGAAATGC
RS5R    CGAATCATTAAAGTGGGTATCAC
PLAC1	CACCCAAGGCTCTGCTCCCACAAT
PLAC4	ACTGTGCGTTAGGTCCTGTTCATTGTT

PRY and PLAC primers are from the Berkeley Drosophila Genome Project at http://www.fruitfly.org/about/methods/inverse.pcr.html